Fuzheng Liu Examines Transformer-XL Modeling of E-Commerce User Behavior and Real-Time Behavioral Analysis

XL, dynamic interest modeling, and distributed stream computing to analyze large-scale e-commerce user behavior. By improving long-sequence prediction, real-time processing, and behavioral clustering, ...
EDN

Neural implant merges photovoltaics with custom analog, PPM encoding

Consider a neural implant dubbed the Microscale Optoelectronic Tetherless Electrode, or MOTE, developed at Cornell University ...
IEEE

NIDC: General Task Backbone for Neuroimaging Analysis via Interpretable Deep Clustering

Abstract: Clustering techniques offer strong interpretability. However, they have significant limitations in the deep learning area due to their difficulty in capturing complex data structures, such ...
Nature

The gene encoding gigaxonin, a new member of the cytoskeletal BTB/kelch repeat family, is mutated in giant axonal neuropathy

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
GitHub

Combining Global and Local Attention with Positional Encoding for Video Summarization

From "Combining Global and Local Attention with Positional Encoding for Video Summarization", Proc. of the IEEE Int. Symposium on Multimedia (ISM), Dec. 2021. Written by Evlampios Apostolidis, ...
GitHub

GRAPE: Group Representational Position Encoding

GRAPE is a unified group-theoretic framework for positional encoding that subsumes multiplicative mechanisms (like RoPE) and additive mechanisms (like ALiBi and FoX) under a single mathematical ...
IEEE

Position Awareness Network for Noncooperative Spacecraft Pose Estimation Based on Point Cloud

Abstract: Spacecraft pose estimation plays a vital role in many on-orbit space missions, such as rendezvous and docking, debris removal, and on-orbit maintenance. At present, the mainstream ...